Блок фбс габариты: цены, размеры ФБС 24 6, 24 4 – МЕТАЛЛОМАРКЕТ в Москве

Содержание

размеры, цены, преимущества и недостатки блоков ФБС

Блоки ФБС представляют собой часть фундамента, которые могут использоваться как в сочетании с ленточным фундаментом, так и выступать в роли главного элемента основания строения.

ФБС дословно трактуется как фундаментные блоки стен. Эти строительные элементы имеют форму прямоугольного параллелепипеда. В основном они выливаются из тяжелых марок бетона и оснащены мощным армирующим каркасом. С обоих торцов блоки оснащены пазами, которые при монтаже элементов конструкции друг к другу заливаются бетонным раствором.

Основными областями применения ФБС являются обустройство сборного ленточного фундамента, технических помещений небольшой высоты, подвальных помещений, где ФБС выступают в роли стен.

Стандартные размеры блоков, их разновидности и ориентировочные цены

Многие производители ФБС помимо стандартных блоков предлагают потребителям так называемые доборные, которые имеют меньшую длину и позволяют точно подгонять размеры фундамента под строительный проект.

Наиболее распространенные габариты ФБС, выпуск которых налажен для широкого потребления, имеют следующие показатели и технические характеристики:

Тип Длина (дм) Ширина (дм) Высота (дм) Вес (т) Цена
24.3.6т 23,80 3 5,80 0,97 1600-1700р
24.4.6т 23,80 4 5,80 1,30 2100-2600р
12.3.6т 11,80 3 5,80 0,50 970-1300р
12.4.6т 11,80 4 5,80 0,64 1300-1360р
12.5.6т 11,80 5 5,80 0,79 1640-1680р
12.4.3т 11,80 4 2,80 0,31 650-660р
9.3.6т 8,80 3 5,80 0,35 740-760р
9.4.6т 8,80 4 5,80
0,47
960-1100р

Для того чтобы разобраться с маркировкой основных типов следует отметить, что первая цифра в кодировке свидетельствует о длине блока, вторая – ширине, третья — высоте. Все показатели измеряются в дециметрах. Последняя буква в кодификации — Т, обозначает, что при изготовлении элемента использовался тяжелый бетон.

При изготовлении фундаментных блоков используются такие классы бетонных растворов как B7,5 (М100), В12,5 (М150), В15 (М200). Наиболее распространены изделия из бетона класса В7,5, они имеют уровень плотности 2400кг/м.куб и класс морозостойкости F50.

Основополагающим нормативным документом, стандартизирующим выпуск ФБС является ГОСТ 13579-78.

Основные преимущества блоков ФБС

Зарекомендовавшие себя с лучшей стороны блоки ФБС при строительстве как жилых, так и нежилых зданий имеют ряд преимуществ перед заливными фундаментными конструкциями, такие как:

  • долговечность. Блоки ФБС изготовленные в соответствии с установленными требованиями и стандартами могут служить до 150 лет;
  • высокая прочность. Блоки изготавливаются в специальных условиях, и в отличие от заливного бетонного фундамента, процесс застывания происходит не во влажной грунтовой среде;
  • быстрый монтаж. Блоки, собирающиеся в единый элемент по принципу конструктора, позволяют ускорить процесс обустройства фундамента, что значительно сокращает временные затраты.

Из недостатков следует выделить более высокую стоимость по сравнению с обычным ленточным фундаментом и дополнительные затраты на обслуживание и защиту готовой конструкции. Так, после монтажа блоков следует особое внимание уделить гидроизоляции фундамента и его утеплению. Ведь в местах стыков образуются губительные пороги холода, которые негативно влияют на соединительный раствор и при недостаточном утеплении попросту могут со временем разрушить его.

размеры и ГОСТ железобетонных блоков

Самый распространенный и простой вид обустройства фундамента под дом – использование бетонных блоков. Фундаментные блоки не требуют опалубки, а прочность обуславливается заводским способом изготовления, посредством применения процессов вибрирования и пропаривания бетонной смеси. Кроме строительства оснований, блоки ФБС используют для обустройства пандусов, стенок подпорного характера, заборов, эстакад и платформ. Единым регламентным документом является ГОСТ 13579, допускающий применение в производстве изделий силикатные смеси легкого типа плотностью не менее 1800кг/1м3.

ФБС в строительстве

Блоки ФБС – это фундаментные блоки сплошные, представляющие собой бруски кубической формы, изготовленные из бетонной смеси, армированные

Блоки ФБС – это фундаментные блоки сплошные, представляющие собой бруски кубической формы, изготовленные из бетонной смеси, армированные. Материал показан для применения в строительстве частного малоэтажного типа и застройке объектов различных малых форм, позволяет снизить стоимость проектов и значительно повысить оперативность проведения строительных процессов.

Важно! При создании фундамента на слабом грунте, для перераспределения нагрузки, блоки ФБС необходимо опирать на «подушки», представляющие собой вид плит призматического типа.

Преимуществами использования продукции можно назвать следующие факторы:

  1. Снижение временных потерь для обустройства фундамента. Благодаря тому, что продукция не требует выдержки, как, например, основания ленточного типа, стеновые панели строения можно возводить практически сразу после выкладки фундамента.

Совет! Лучше всего заниматься обустройством основания из ФБС в теплое время года, выбрав период без дождей.

  1. Наличие специальных присадок в фундаментных блоках ФБС обеспечивает высокую морозостойкость и неподверженность агрессивной среде. Благодаря этому показателю, продукция стойко переносит большие перепады температурных режимов в течение суток.
  2. Модальное разнообразие. Широкий ряд типовидов позволяет подобрать размеры блоков ФБС по требованиям каждого застройщика, а качество гарантируется заводским образом изготовления железобетонных конструкций.

Важно! Изготовить самостоятельно блоки для фундамента нельзя. Отсутствие оборудования для вибропрессования приведет к нарушению технологического процесса и изделие не выдержит положенных нагрузок.

  1. Стандартизированные ГОСТ размеры помогают точно просчитать количество продукции, необходимое для обустройства несущей основы.
  2. При соблюдении условий монтажа, эксплуатации, блочный фундамент прослужит не менее 70-90 лет.

Совет! Несмотря на огромный ассортиментный и размерный ряд, фундаментные блоки ФБС имеют немалый вес, поэтому для подъема продукции и монтажа на место, потребуется техника.

Разновидности блочной продукции

Сегодня самым популярным материалом считается бетонный блок для строительства фундамента

Сегодня самым популярным материалом считается бетонный блок для строительства фундамента, обозначаемый аббревиатурой ФБС. Кубический продукт используется как для создания несущей основы, так и для обустройства наружных, внутренних, несущих стеновых панелей. Регламент ГОСТ стандартизирует размеры всего модельного ряда:

  • Железобетонные кубы при показателе длины 2380 мм могут быть 300-600 мм толщины (шаг изменений 100 мм), высота 580 мм.
  • Железобетонные бруски длины 1180 мм могут иметь толщину: 400, 500, 600 мм, высоту 580 и 280 мм.
  • Доборные блоки ЖБИ (укороченные) при длине 880 мм могут быть толщиной 300-600 мм, высоты 580 мм.

Весовая градация в зависимости от размерных градаций составляет 380-1960 кг, плотность 2400кг/м3.

Рекомендуем к прочтению:

И немного о других изделиях, которые имеют некоторую сходность с продукцией ФБС:

  1. ФБВ – это штучные изделия, выпускаемые малыми партиями. Отличие в том, что кубы оснащены продольным вырезом, особенно удобным для прокладки инженерных коммуникаций. Как правило, изделие имеет длину 88 см, ширину 40-60 см, высоту 58 см.
  2. ФБП – продукция облегченного типа, имеющая квадратные пустоты. Имея параметры длины 238 см, ширины 40-60 см, высоты 58 см, бруски идеально подходят для обустройства стен и перегородок внутреннего типа в подвальных помещениях, а также применяются для строительства оснований под тяжелые установки промышленного свойства.

Маркировка ФБС

Все блоки фбс изготавливаются в соответствии с ГОСТ и имеют свою маркировку

В соответствии с ГОСТ, обозначение параметров продукции округляется до 1 дм. Так:

  1. Сплошной блок с размерами стандартного характера обозначается ФБС 24.4.6 т (тяжелые бетоны). Минимальный вес 260 кг, максимальный 2 тонны (при плотности 2300 кг/м3).
  2. Если фундаментный блок изготовлен из легкого бетона, ставится маркировка «Л» или «П» (при использовании пористого наполнителя – керамзита). Минимальный вес такой конструкции будет 230 кг, максимальный 1470 кг при плотности 1800 кг/м3.
  3. Наличие буквы «С» после цифры, обозначает использование силикатного бетона в качестве одного из компонентов сырья. Масса минимум составит 163 кг, максимум 250 кг. При этом показатели длины 238 см, ширины 60 см. Плотность 2000 кг/м3.

Важно! Железобетонные кубы заводского изготовления всегда имеют пару проушин, изготовленных из стального проволочного прутка диаметром не менее 12 мм. Петли предназначены для облегчения монтажных работ.

Характеристики продукции

Фундаментные блоки выбираются по назначению материала

Кроме того, что фундаментные блоки выбираются по плотности и массе, есть немало свойств, влияющих на определение назначения материала:

  1. Типоразмер. Блоки под фундамент нужно определять по форме, назначению и маркировке:
  • В форме цилиндра с литерой «Ф» — продукция, используемая для оснований свайного, столбчатого типа.
  • Железобетонные изделия в форме трапеции применяются как опора под ленточное, столбчатое основание, имеют маркировку «ФЛ», параметры регламентированы ГОСТ 13580-85.
  • Элементы в форме прямоугольника, оснащенные ушками на торцах – это блоки ФБС, на фото показаны именно они, применяются для устройства ленточного фундамента, строительства цокольных этажей, возведения стен. Размерные градации указаны в ГОСТ 13579-78.
  • Пустотелые изделия, предназначенные для создания опалубки несъемного типа, обозначаются «ФБП». Показаны для строительства многоэтажек, в малоформатном частном домострое применение материала невыгодно – огромный запас прочности не будет использоваться полностью. ГОСТ 13579-78.
  • Балки в форме прямоугольника, трапеции имеют маркировку «БФ» и нормированы ГОСТ 28737-90.

Расшифровка обозначений довольно проста

Расшифровка обозначений довольно проста: обозначения цифр – это габариты элементов (дм): первая – размер длины, вторая – ширины, третья – высоты. Размеры и вес продукции предусматривают применение крана, лебедки, но производители предлагают малоформатные блоки для фундамента 20*20*40 см, которые, как правило, выпускает тот же завод, что и крупноформатную продукцию. Производство включает процессы вибропрессования, при этом используется раствор портландцемента, чистого песка и крупного заполнителя, благодаря чему достигается нужная плотность раствора.

Важно! Если заполнитель гравийного типа, блок называется бетонным, если керамзит –керамзитным.

Различаются малоформатные блоки для фундамента на полнотелые и пустотелые:

Рекомендуем к прочтению:

  • Полнотелые элементы показаны для обустройства оснований под малоэтажные (1-3 этажа) строения на прочных грунтах.
  • Пустотелые элементы идеальны для строительства стеновых панелей.

Важно! Удобство работы обеспечено малым весом кубов – до 40 кг, однако при выкладке фундаментной основы необходимо дополнительное армирование, например, дополнение в виде армировочной сетки по горизонтальному шву. В случае ненадежности грунта, создается армопояс увеличенной высоты.

  1. Морозостойкость. Определяется норматив только по сертификатам, которые выдаются на продукцию и исчисляется в количестве циклов полного замораживания/оттаивания продукции.
  2. Устойчивость к агрессивным средам – еще один параметр, необходимый для учета. Выбирать тип бетона в этом случае лучше с помощью предварительно проведенного теста почвы. Тестеры продаются в магазинах строительных материалов и стоят примерно $ 2. Проведя испытания, застройщик сможет подобрать стеновый или фундаментный материал с щебенным заполнителем – они намного прочнее, чем керамзитные и более стойкие к щелочным воздействиям кислых грунтов.

Цена блоков

Цена блоков от 10 до 35$ за штуку в зависимости от конфигурации

Точно определить стоимость блоков сможет только застройщик, который не поленится прозвонить производителей и уточнить, сколько стоит та или иная продукция. Однако, примерные ценовые градации очертить можно:

  1. Небольшой доборный элемент тяжелого бетона ФБС-6-3-6т стоит от $10 за штуку.
  2. Цена на продукт длиной 1,2 м (ФБС-12-3-6т) будет уже от $ 16 за штуку.
  3. Серия блоков длины 2,4 м и толщины в 0,4 м оценивается от $35 за штуку.

Важно! Предлагаемые на рынках жб изделия, бывшие в употреблении – не самый лучший вариант для застройщика, несмотря на весьма привлекательную цену. Наличие сколов, прочих дефектов может негативно отразиться на качестве и сроке эксплуатации готового строения. Однако, если предполагается возведение хозпостройки малого формата и рядом есть опытный застройщик, он поможет определить блочную продукцию с минимальным количеством изъянов и получится неплохая экономия на покупке стройматериала.

А вот чтобы визуально определить качество, достаточно проверить продукцию на:

  • Ровную геометричность форм.
  • Отсутствие сколов, кривизны.
  • Выяснение плотности, путем расчета веса, параметров: для керамзитных кубов плотность не должна быть ниже 1800кг/м3, для бетонов не ниже 2000 кг/м3. Только такие элементы можно использовать для создания несущей основы.

И последний тест – сбросить блоки с одинаковой высоты – рассыпались в труху, товар явно с нарушением технологии и состава сырья. Если же сколы минимальны, то ФБС действительно хорошего качества и такое основание прослужит невероятно долго, дом будет стоять не одно десятилетие и лишь порадует качеством фундамента.

характеристики и размеры, расшифровка маркировки, цены

Фундамент принимает на себя нагрузку от стен, крыши, перекрытий и равномерно распределяет ее на землю. Выбор искусственного основания зависит от гидрологических и геологических условий, а также типа и массивности строения. Для участков с твердым грунтом и незначительной влажностью рекомендуется использовать фундаментные блоки строительные (ФБС). Что собой представляет такой базис, какие бывают размеры, вес и как дорого можно его приобрести? Чтобы ответить на все вопросы, подробно изучим особенности.

Оглавление:

  1. Технические параметры
  2. Маркировка и типовые размеры
  3. Плюсы и минусы
  4. Сфера применения и цены

Характеристики

Согласно ГОСТ 13579-78 в производстве используются тяжелые, керамзитные или плотные силикатные бетоны. Это сырье конструкционного типа, из которого получают литые изделия повышенной крепости и плотности. К соблюдению стандартных размеров и веса фундаментных блоков предъявляются самые строгие требования. От этого зависит прочность основания и долговечность всего строения.

Так как элементы испытывают нагрузку на сжатие, в них присутствует внутренняя арматура, предусмотрена закладка монтажных петель из гладкого горячекатаного прутка. Это необходимо для удобства перемещения и транспортировки плит ФБС.

Для придания строительному материалу соответствующей твердости применяют две технологии:

  • Просушка – схватывание бетона происходит естественным образом. Блоки располагают в крытом проветриваемом помещении и выдерживают в течение нескольких недель.
  • Пропарка – ускоренный способ обработки под воздействием высокого давления в условиях повышенной влажности. Достичь нормативной твердости в 70 % удается всего за сутки.

Качество изделий, полученных разными способами, совершенно одинаковое. Но из-за дорогой технологии цена пропаренных немного выше.

Условные обозначения

Аббревиатура ФБС дословно расшифровывается как фундаментные блоки строительные или сплошные. Под названием подразумевается цельная отливка с гладкими поверхностями. По форме она напоминает кирпич, только гораздо большего размера. В торцах имеются неглубокие вырезы, которые заполняют бетоном, соединяя элементы между собой во время монтажа.

Кроме типовых форм существуют другие виды, отличающиеся конфигурацией.

1. ФБВ – с отверстиями для прокладки инженерных коммуникаций и укладки перемычек.

2. ФБП – модули с пустотными камерами, открытыми вниз.

В нормативной документации предусмотрены такие типовые размеры блоков ФБС:

  • длина 600/900/1200/2400 мм;
  • ширина 300/400/500/600 мм;
  • высота 300/600 мм.

Вес изделий разных габаритов может колебаться от 0,25 до 2 тонн.

Маркировка включает в себя тип, размеры в дециметрах и вид бетона. Например, расшифровка ФБС12.3.6–Т выглядит так:

  • ФБС – фундаментные блоки сплошные;
  • 12 – длина 1180 мм;
  • 3 – ширина 300 мм;
  • 6 – высота 580 мм;
  • Т – тяжелый бетон.

Зная основные размеры, определяют, сколько всего штук нужно купить для строительства. Ориентируясь на вес, рассчитывают число модулей для перевозки в одной машине. Если в этих выкладках учесть актуальную стоимость, то нетрудно запланировать предварительную сумму расходов.

Преимущества и недостатки

Намечая строительство на основе ФБС, следует хорошо взвесить их сильные и слабые стороны. Это поможет утвердиться в целесообразности выбора основного материала.

Достоинства:

1. Высокая прочность. Бетонные блоки способны равномерно распределять и выдерживать значительные нагрузки.

2. Универсальность применения. Материал активно востребован в гражданском и промышленном строительстве.

3. Устойчивость к погодным условиям Независимость от времени года и атмосферных явлений позволяет проводить работы круглый год в любой климатической зоне.

4. Стандартные размеры. Типовые габариты позволяют делать точные расчеты стройматериала при закупке.

5. Сжатые сроки монтажа. При заказе готовой конструкции отпадает необходимость в трудоемком и длительном процессе изготовления монолитной плиты. Ускоренные темпы строительства снижают общую стоимость блочного объекта на 20-25%.

6. Простота укладки. Благодаря стальным петлям, закрепленным в бетоне, упрощается разгрузка краном и монтаж.

7. Конструктивность. Наличие пазов усиливает соединительные швы.

8. Долговечность. Расчетный срок службы построек из блоков составляет 40-50 лет.

Недостатки:

  • Необходимость привлечения бригады профессиональных строителей и специальной техники.
  • Большой риск проседания отдельных участков фундамента.

Где применяются ФБС?

Сплошные бетонные изделия предназначены для закладки фундаментов многоэтажных или массивных строений. Основания из блоков и монолитных плит находятся на одном качественном уровне. Однако использование первых значительно снижает стоимость и ускоряет строительство. Они активно применяются при сооружении цокольных этажей, погребов, подвальных, технических помещений, неотапливаемых объектов. Для кладки стен подходят пустотные модули ФБП, вес которых намного меньше.

Блоки, уже побывавшие в употреблении, продаются по стоимости, сниженной на 30-50 %. Поэтому их нередко применяют в качестве стационарного или временного ограждения различных объектов.

Маркировка изделийМасса, кгЦена, руб/шт
6-3-6240-250690-850
6-4-6300-310860-960
6-5-6350-3901010-1020
9-3-6350-370580-990
9-4-3220-240690-820
9-4-6470-490780-1230
9-5-3280-300750-970
9-5-6590-610980-1550
9-6-6700-7401230-1850
12-3-3240-270450-630
12-3-6460-510770-1280
12-4-3310-330530-1100
12-4-6640-6751060-1670
12-5-3360-380670-1360
12-5-6790-8001300-2070
12-6-3460-480810-1490
12-6-6940-9601580-2500
24-3-6970-10251520-2350
24-4-61300-13502000-3000
24-5-3790-12001700-2200
24-5-51560-15902690-3200
24-5-61630-16802500-3650
24-6-31000-10202040-3100
24-6-61960-19803000-3970

Блоки ФБС размеры и цены, вес блоков ФБС, блоки ФБС 6 цена, стоимость ФБС, ФБС 3.

Главная»Статьи»Блоки ФБС размеры и цены

Блоки для фундамента – специализированные строительные материалы для их сооружения, а также для строительства небольших технических помещений. Блоки ФБС, размеры и цены которых способны удовлетворить любые требования покупателей, принадлежат к той категории изделий из железобетона, без которых невозможно сооружение современного здания. Причем размеры, необходимые для каждого конкретного случая зависят от степени нагрузки, которую должны будут выдерживать бетонные блоки, а стоимость ФБС напрямую зависит от их размеров.

            Фундамент – основа любого здания, поэтому особенно важно качество и прочность железобетонных изделий. Долговечность всего строения зависит еще и от оптимально побранных размеров, а также от профессионализма выполненных монтажно-строительных работ.

            ФБС отличаются между собой по таким показателям, как прочность на сжатие, водонепроницаемость, морозостойкость, габаритные размеры. На выбор бетонных изделий влияют конкретные задачи, которые предстоит решить, а также, условия эксплуатации. Так для высоких расчетных нагрузок следует использовать блоки ФБС 6, цена которых немного выше, чем, например стоимость ФБС 3. Более тонкие блоки подойдут для более легких конструкций. Следует учитывать и климатические условия, количество этажей строящегося сооружения, качество грунтов и их подвижность.  

                                                        

Тип бетонных блоков зависит от назначения нового здания. Различают такие типы ФБС, как ленточные, сплошные, массивные, колонные. Для того чтобы определить необходимый тип бетонного блока, надо точно знать его назначение, для строительства чего он будет применяться. Благодаря своей экономически выгодной цене и высокой рентабельности железобетонные блоки обладают большими преимуществами, перед традиционными способами строительства фундаментов.   

Размеры блоков ФБС для фундамента: разновидности и размерность

В тех случаях, когда необходимо возвести ленточное основание в минимальный отрезок времени, вам потребуются блоки ФБС для фундамента. Они представляют собой одну из разновидностей ж/б изделий, которые нашли своё применение при установке сборных строений из ФБС. Необходимы фундаментные блоки сплошные (так расшифровывается аббревиатура ФБС) для постройки фундаментных стен. Сегодня речь пойдёт о том, какие существуют размеры блоков фбс для фундамента, их сортамент и основные особенности, и нюансы, связанные с их применением.

По своей форме сплошной фундаментный блок является параллелепипедом прямоугольной формы, который отливают из бетона. На торцах изделия выполнены выемки прямоугольной формы. Они сделаны для того, чтобы облегчить процесс заливки шва при монтаже. Обычно ФБС-блоки производятся на заводах, выпускающих железобетонные изделия. Их производство предусматривает применение технологии вибрационного прессования. Спрессовать цельное изделие можно только в условиях заводских стендов, поскольку конструкции ФБС могут достигать вес около полутора тонн.

Разновидности конструкций

По своему сортаменту такая конструкция различается по разнообразным критериям. Сюда относится классификация по виду применяемой в производстве арматуре, а также по разновидности раствора, используемом в процессе заливки железобетонных изделий.

Если исходить из классификации по первому критерию, то виды блоков фбс подразделяются на:

  • Продукцию с каркасом напряженного типа. Он производится из арматурных элементов растянутого или закаленного вида.
  • Продукцию с каркасом ненапряженного типа. Изготавливается такой вид из арматуры, не подверженной обработке.

Стоит отметить также и то, что в обеих ситуациях используется стальная арматура, в основу которой вошла марка А1 либо А111.

Если исходить из типа бетонных блоков, то они различаются по второму критерию на следующие разновидности:

  1. Железобетонная продукция, при изготовлении которой использовался тяжелый бетон. В его основу пошел раствор, марка которого М250 или М300. Также нередко используется раствор, имеющий марку М400.
  2. Ж/б продукция, выполненная из бетона лёгкого типа. Она производится из растворов марки В150. Здесь же актуальным является использование и не менее популярной марки В100.
  3. Железобетонные конструкции, выполняемые из керамзитобетона, которые производились из специализированного раствора, в его основу положен керамзит гранулированного типа. Он играет в нём роль своеобразного армирующего наполнителя.

От того, к какой из групп относится то или иное изделие, зависит, какие размеры блоков бывают, а также какой может быть вес и их стоимость, что, скорее, является следствием из вышеперечисленных признаков.

Преимущества и недостатки рассматриваемых конструкций

Современные блоки ФБС обладают массой преимущественных характеристик. К их числу можно отнести следующие:

  • Отличная несущая способность изделия, которую можно сравнить со свойствами монолита литого типа.
  • Прекрасная устойчивость к разного рода вредным воздействиям окружающей среды. Блок, который был предварительно спрессован на специализированном вибростенде, отличается двумя ключевыми характеристиками. Сюда можно отнести наименьшую пористость и высокую поверхностную твёрдость. Проще говоря, к минимуму снижается возможность заплесневения внутренней структуры ФБС блока.
  • Также к числу достоинств можно отнести и крупногабаритность изделий. Объясняется это тем, что становится возможным ускорение хода возведения фундамента. Самым большим блоком ФБС для основания является такое изделие, которое по своим параметрам способно заполнить практически одну четвёртую часть десятиметровой стены, выполненные из ленточного основания. Таким образом, с целью возведения фундамента мелкозаглублённого типа потребуется наличия всего лишь на всего шестнадцати единиц рассматриваемого изделия. В том случае, если основание планируется погрузить глубоко, то его необходимо будет сложить из тридцати двух блоков. Они складываются из двух рядов.

Однако у рассматриваемых блоков ФБС есть и некоторые слабые стороны. Необходимо перечислить и их:

  • Крупный вес продукции, который обуславливают размеры блоков фбс для фундамента. Если поискать и найти самый маленький фундаментный блок, то его вес будет составлять не одну сотню килограмм. Всё это ведёт к необходимости использования тяжёлой строительной техники при установке фундаментных стен из ФБС.
  • Не хватает кладке из таких блоков и показателей герметичности. В фундаментных стенах есть некоторые уязвимые места, которые базируются в кладочных швах. Из-за своих физических характеристик они склонны к притягиванию грунтовых вод. Однако эта проблема поддаётся устранению. Для этого всегда внешняя часть изделия оснащается надёжным гидроизоляционным слоем.
  • Также недостаточны показатели теплостойкости. Справедливости ради отметим, что этот «минус» характеризует также и заливку ленточного типа.

Кроме всего прочего, к числу слабых сторон можно отнести ещё одну, которая заключается в некоторой дороговизне, которая присуща процессу возведения фундамента из подобного рода блоков. Так, к примеру, такие конструкции могут обойтись примерно на треть дороже, нежели ленточный фундамент.

Размерность изделия

В этом разделе рассмотрим, какие размеры блоков использовать для фундамента. Габаритная составляющая определяется исходя из специального нормативного документа. Им является государственный стандарт – ГОСТ. Изложены здесь не только основные параметры продукции, а также и некоторые отклонения от них, которые возможны и допустимы. Исходя из параметров длины изделия, оно классифицируются на три разновидности.

Габариты продукции могут составлять 9, 12 и 24 дм. Что касается критерия высоты, то здесь также имеет места классификация, только уже на два типа – 3 и 6 дм. Согласно показателям ширины, данная разновидность железобетонных изделий классифицируется на 4 типа, среди которых продукция представлена с данным параметром от 3х до 6ти дм.

Также, кроме всего вышеперечисленного, имеет место продукция, изготавливаемая исходя из отраслевых нормативов. Благодаря ним становится возможным возведение основания с нестандартными параметрами.

Установка сборного фундамента

Устанавливаются бетонные блоки фбс в несколько этапов, причём в рамках первого осуществляется разметка и рытьё котлована. Следует отметить, что подобные изделия подразумевают под собой традиционный котлован, имеющий выемку прямоугольного типа. Что касается осуществления разметки, то она выполняется с использованием проволоки. Понадобиться могут также и вехи, с помощью которых очерчивается высшая граница разрабатываемого котлована. Параметры её обычно превышают соответствующие габариты основания на глубину заложения фундаментной подошвы.

Данный этап, в рамках которого осуществляются земляные работы, оканчивается тем, что необходимо засыпать песчаную подушку. Выполняется эта операция на дне траншеи, которая была предварительно обустроена по периметру котлована. Что касается габаритов выемки, то они должны быть идентичны габаритам фундаментной подошвы. В данном случае имеется в виду ширина.

Далее сборка основания осуществляется по следующей схеме:

  1. Поверх песчаной подушки укладывают рубероидную ленту;
  2. Далее устанавливается ФЛ блок;
  3. Поверх него устанавливается ряд блоков ФБС. При укладке сплошных блоков используется принцип «от угла к центру». Швы должны быть заполнены посредством специализированного скрепляющего раствора.
  4. После этого укладывается следующий блочный ряд. Его необходимо монтировать согласно принципу кирпичной кладки. Он заключается в том, чтобы вышестоящая единица продукции обосновывалась на двух нижележащих. Таки образом, вертикальный шов будет перекрыт центром верхнего изделия.
  5. По окончанию установки стенок, на верхние грани последнего блочного ряда заливается ростверк монолитного типа.

Если вы не будете пренебрегать основными правилами, то всё завершится успешно. В данной статье мы постарались рассказать вам о том, какие блоки фбс бывают, их параметры, слабые и сильные стороны, а также описали процесс установки. Надеемся, что эти знания окажутся полезными для вас. Успешного строительства!

размеры фундаментных блоков фбс

Вернуться на страницу «Железобетон»

Фундаментные блоки

 

Согласно ГОСТ 13579-78:

ФБС — сплошные;

ФБВ — сплошные с вырезом для укладки перемычек и пропуска коммуникаций под потолками подвалов и технических подпольев;

ФБП — пустотные (с открытыми вниз пустотами).

Тип блока Основные размеры блока, мм
Длина l Ширина b Высота h
ФБС 2380 300;400;500;600 580
1180 400;500;600
400;500;600 280
880 300;400;500;600 580
ФБВ 400;500;600
ФБП 2380 400;500;600 580

Блоки типа ФБС

А. Блоки шириной 300 мм

Б. Блоки шириной 400, 500 и 600 мм

Черт. 1

Блоки типа ФБВ

1.3. Структура условного обозначения (марок) блоков следующая:

Пример условного обозначения блока типа ФБС, длиной 2380 мм, шириной 400 мм и высотой 580 мм, из тяжелого бетона:

ФБС24.4.6-Т ГОСТ 13579-78

То же, типа ФБВ, длиной 880 мм, шириной 400 мм и высотой 580 мм, из легкого бетона:

ФБВ9.4.6-Л ГОСТ 13579-78

То же, типа ФБП, длиной 2380 мм, шириной 500 мм и высотой 580 мм, из плотного силикатного бетона:

ФБП24.5.6 -С ГОСТ 13579-78

1.4. Марки и характеристики блоков из тяжелого бетона приведены в табл. 2, из легкого бетона — в табл. 3, из плотного силикатного бетона — в табл. 4.

При соответствующем обосновании допускается применение блоков из бетонов классов по прочности на сжатие, отличающихся от указанных в табл. 2 — 4. При этом во всех случаях класс бетона по прочности на сжатие должен приниматься не более В15 и не менее:

В3,5 — для блоков из тяжелого и легкого бетонов;

В12,5 — для блоков из плотного силикатного бетона.

Блоки ФБС. Размеры и способы монтажа на стройке

Блоки ФБС (Фундаментные стеновые блоки) от компании «Строитель-М» это изделия из тяжелого бетона класса В15. ФБС предназначены для возведения сборных фундаментов, стен подвалов, цоколей домов.

Фундаментный блок используют при необходимости быстрого монтажа подземных конструкций без установки опалубки. По сравнению с монолитным, возведение сборного основания можно вести даже зимой, не заботясь о прогреве бетона и сделать его за несколько дней. Сфера применения включает как частное малоэтажное строительство, так и высотные дома. Высокая прочность достигаются применением тяжелого бетона.

Размеры ФБС по ГОСТ 13579-78.

ФБС в поперечном сечении прямоугольные, имеют петли для облегчения транспортировки и монтажа. Они рассчитаны только на передачу веса сооружения на грунт, поэтому согласно ГОСТа не армируются. Металл присутствует только в качестве закладных элементов. По торцам блоков есть специальные 30мм углубления для дополнительного сцепления элементов цементным раствором и расположения монтажных петель.

«Строитель-М» выпускает бетонные блоки длиной 2380 мм при высоте 580мм. Варьируется только ширина: 300, 400, 500, 600 мм. Отклонения от гостовских размеров не превышают ±13 мм по длине и ±5 по высоте и ширине. Точные геометрические размеры позволяют избежать погрешностей при строительстве. Внушительные размеры и вес элементов подразумевают их монтаж только подъемной техникой, при наличии удобного подъезда к объекту.

Особенности монтажа

Перед поднятием первого блока, убедитесь в том, что опоры крана находятся находятся на достаточном расстоянии от края котлована или траншеи во избежание сползания или осыпания грунта. Если проектные размеры стены не кратны длине ФБС, пустые промежутки можно заполнять бетонной смесью или планировать прохождение в них водоводов и прочих сетей.

Подготовка основания

На первом этапе разбивают оси на дне готового котлована, заглубленного ниже глубины промерзания (для района Урала это не менее 1,8м).  По осям основания натягиваются нити на колышках с соблюдением прямых углов. Прямой угол выдерживается специальным лазерным разметчиком. Далее от осевой нити на расстояние половины ширины блока с припуском до 5см натягивают шнуры, обозначающие внешние грани блочного фундамента.

Укладку ведут на выровненный и уплотненный грунт или предварительно подготовленное песчаное основание (толщиной не менее 10 см), очищенные от снега или воды на дне котлована или траншеи.

Если грунт песчаный, монтировать можно прямо на выровненную поверхность. Поперечная ширина песчаного основания должна быть больше опорной части блоков на 20-30 см.

Необходимые инструменты и материалы:
  • Комплект блоков с подготовленными для сетей отверстиями;
  • строительный кран;
  • бетономешалка.
  • песок крупной фракции;
  • цементобетонная смесь;
  • плоская арматурная сетка;
  • гидроизоляционные материалы;
  • лопата;
  • лазерный уровень и отвес;
  • бечевка и колышки для разметки;
Установка блоков

Начинают установку с угловых участков, не забывая связывать наружные стены с внутренними перегородками. В процессе тщательно проверяют горизонтальные и вертикальные уровни. Все швы плотно заполняются цем.раствором. ФБС размещают со смещением швов вразбежку (перевязкой) на расстояние не менее 25-60 см подобно кирпичной кладке с чередованием рядов.

Перемещение блоков проводится подъемным краном в присутствии профессионального такелажника. Поверхности изделий заранее очищают от грязи и слегка смачивают для лучшего сцепления с цементным раствором. Минимальная толщина цементной стяжки составляет 15 мм. Вертикальные швы заполняются с двух торцов раствором и уплотняются.

Отверстия под инженерные коммуникации намечают и пробивают в блоках заранее на этапе монтажа. Так же их можно предусмотреть простым горизонтальным смещением фбс-блока. Входы и стыки для сетей обрабатывают гидрофобными составами.

Внешняя гидроизоляция

По верхнему ряду основания выполняется гидроизоляция. А при наличии повышенной влажности грунтов – дополнительно проводят мероприятия по гидрофобизации наружных поверхностей. Стандартно это обмазка гудроном или специальными составами.

Цена фундамента

В финансовом плане монтаж фундамента из ФБС — наиболее экономичен. Подсчитать расходы на стройматериалы несложно. И, хотя 1 куб. блоков-ФБС стоит несколько дороже куба бетона, вы сэкономите на опалубке и арматуре. Земляные работы в любом случае одинаковы. Узнать цены и Заказать ФБС можно ЗДЕСЬ

Фундамент дома из ФБС. Если строите дом, то бетонные блоки ФБС — идеальный вариант фундамента дома.


Бетонный блок ФБС, пожалуй, самый распространенный вариант для строительства фундамента дома. И чаще всего используется сплошной бетонный фундаментный блок, обозначаемый аббревиатурой ФБС. Их используют для монтажа фундаментов домов под наружные и внутренние несущие стены.

Кроме того, бетонные блоки используют для сооружения подпорных стенок, пандусов, заборов, платформ и эстакад.

В производстве фундаментных блоков сплошных (ФБС) предприятие «Строитель-МП» применяет Технические условия производства, типовые размеры и прочностные характеристики, регламентируемые Государственным стандартом № 13579 от 1978 года.

Преимущества бетонных блоков для фундамента

  • Значительное снижение сроков строительных работ, чем при заливке монолитного фундамента дома. Мы, кстати оказываем услугу по заливке монолита собственным бетононасосом 21 куб.м.;
  • Стандартные размеры блоков позволяют быстро и точно рассчитать нужное количество ФБС;
  • Нет необходимости в дорогостоящей опалубке, добавках против замерзания бетона;
  • Долговечность сборного фундамента более 100 лет (при правильном монтаже и соблюдении условий эксплуатации).

Как выбрать габариты блока ПБС

Любое строительство, как известно, начинается с основания. Он может быть выполнен как методом укладки в траншейную бетонную массу, так и с помощью бетонных блоков. Размеры блока ФБС обычно выбирают в зависимости от степени нагрузки на фундамент и габаритов конструкции. Также, если есть необходимость в определенном цветовом решении, например, нужно разделить основу, тогда используйте блоки разного цвета: серый, красный, желтый, зеленый.

Для укладки в фундамент дома чаще всего используют фундамент из блоков ФБС прямоугольной формы. Размеры выбираются в зависимости от длины и высоты стены, которая будет на них опираться, а также от ее конструктивной системы и материала. Если вы планируете построить многоэтажный дом, то под блоки нужно проложить бетонную подушку.

Фундаментные блоки: размеры и типы

Блоки имеют различную маркировку, соответствующую их типу, например: ФБС — сплошной; FBP — полый, FWB — с вырезом горловины.

Основными размерами блока FBS являются высота, практически неизменная для всех изделий, изготовленных по стандарту (60 см), ширина (всего четыре размера от 30 до 60 см) и длина, кратная 30 (60, 90, 120 и 240 см). Все эти параметры также указываются в дециметровой разметке (например, ФБС 6-3-6 означает, что данный блок предназначен для возведения стен и имеет параметры 6 дм в длину, 3 дм в ширину и 6 дм в высоту). Иногда в маркировке также указывается тип бетона, из которого изготовлен блок: «т» — тяжелый, «п» — пористый, «с» — силикатный.Все остальные размеры блока ПБС могут быть изготовлены на заказ.

Заводское качество — гарантия длительного срока службы

Подбирайте блоки с учетом вертикальной нагрузки, которая определяется расчетом на этапе проектирования здания. Размеры также зависят от плотности бетона, используемого для заливки. Все блоки усилены и имеют специальные петли, с помощью которых их удобно и транспортировать, и ставить на место.

Поскольку блоки производятся на заводе, это гарантирует их высокую прочность и надежность, они устойчивы к внешним воздействиям.Однако для предотвращения проникновения влаги рекомендуется покрыть снаружи гидроизоляционной смесью, особенно если есть вероятность подъема грунтовых вод.

Тонкость монтажа блочного фундамента

Монтаж блочного фундамента выгодно отличается от времени возведения по сравнению с монолитным литым, а также не требует сплошной опалубки за счет того, что блоки ФБС стандартного размера уменьшаются количество вертикальных швов и сделать его более прочным.При расчете необходимого количества блоков не забывайте о кратности 30. Если длина стены делится на 30, вы всегда можете выбрать необходимое количество элементов. Если есть остаток, то блоки можно ставить, а пустоты между ними следует армировать вставками. Готовность фундамента к возведению стен наступает примерно через неделю. Все стыки между блоками, как горизонтальные, так и вертикальные, заполняются раствором, в который рекомендуется вводить гидроизоляционные добавки.На толщину слоя раствора будет влиять размер блока FBS. Для проведения в здании подземных коммуникаций (вода, канализация, электричество) необходимо оставлять небольшие зазоры между элементами в заранее запланированных местах, чтобы их нельзя было впоследствии просверлить.

Phoenix Contact FBS 2-5 — съемный мост для клеммной колодки Технические характеристики

Phoenix Contact FBS 2-5 — вставной мост для клеммных блоков | 3030161

Общие

  • Количество в упаковке

    1

  • Производитель

    Phoenix Contact

Разное

  • Тип продукта

    клеммный блок вставной мост

  • Категория аксессуара

    кабельная разводка и кабельные аксессуары

  • Цвет

    красный

  • Материал продукта

    медь

  • Количество предметов в упаковке

    50

Заголовок

  • Марка

    Phoenix Contact

  • Линия продуктов

    Phoenix Contact

  • Модель

    FBS 2-5

  • Количество в упаковке

    1

Размеры и вес

  • Ширина

    0.4 дюйм

  • Глубина

    0.1 дюйм

  • Рост

    0.9 дюйм

  • Масса

    0.06 унция

Общие

  • Производитель

    Phoenix Contact

Широкоугольный ресивер

| Руководство по позиционированию в футболе

Физические измеримые параметры:

  • Высота: 6 футов 2 дюйма
  • Вес: 190 фунтов.

Статистика:

  • 40 ярдов: 4,5
  • Скамья: 235 фунтов.
  • Приседания: 315 фунтов.

Ключи от автобуса:

Должен быть постоянной угрозой каждый раз, когда он находится на поле. Должен иметь мгновенное освобождение от прямой видимости с низким уровнем площадки и небольшим бесполезным движением, рывком по маршруту, срезанием на один шаг, безупречной ловкостью и способностью отделиться от защитников с редкой максимальной скоростью и неуловимостью.Он должен уметь ловить спорной мяч так же легко, как столб, мелкий, наклонный или заминный. Он должен комфортно бегать по всем маршрутам, обладать редкими навыками владения мячом, отличным сочетанием размера и скорости, а также готовностью блокировать. Он многолетний игрок штата, а в некоторых случаях — всеамериканец.


Физические измеримые параметры:

  • Высота: 6’0 «
  • Вес: 175 фунтов.

Статистика:

  • 40 ярдов: 4.6
  • Скамья: 225 фунтов.
  • Приседания: 295 фунтов.

Ключи от автобуса:

Должен иметь мгновенный выход из зоны прямой видимости с низким уровнем площадки, рывком по маршруту, срезанием на один шаг, выдающейся ловкостью и способностью отделяться от защитников своей скоростью. Он должен уметь ловить спорной мяч так же легко, как сетку, уклон или заминку. Он должен комфортно бегать по всем маршрутам, обладать очень хорошими навыками владения мячом и готовностью блокировать.Он получил награды Общегосударственных и Всеконференционных.


Физические измеримые параметры:

  • Высота: 5’10 «
  • Вес: 165 фунтов.

Статистика:

  • 40 ярдов: 4,6
  • Скамья: 205 фунтов.
  • Приседания: 275 фунтов.

Ключи от автобуса:

Должен иметь быстрое освобождение от прямой видимости, хорошее зрение и инстинкты, хорошие руки, скорость, чтобы защитники промахнулись.Он, как правило, очень атлетичен, быстрее, чем быстр, или обладает скоростью, и он слишком мал для этой позиции. Он готов блокировать и играет с большим мотором. Он получил почетные звания всех конференций.


Физические измеримые параметры:

  • Высота: 5’8 «
  • Вес: 150 фунтов.

Статистика:

  • 40 ярдов: 4,7
  • Скамья: 200 фунтов.
  • Приседания: 265 фунтов.

Ключи от автобуса:

Должен уметь быстро выходить из строя, продавать маршрут игры, делать точные врезки в / из брейков, постоянно ловить мяч и, как правило, быстрее, чем быстро.У него должен быть как минимум 1 год студенческого футбольного опыта.

Творческие характеристики Twitter Ads

Показывайте рекламу в начале ролика, чтобы связать свой бренд с безопасным для брендов премиальным контентом, который уже смотрят ваши клиенты, включая лучшие моменты и лучшие клипы.

Зрителям нравится, когда они могут узнавать о том, что происходит, с помощью видео в Твиттере, от просмотра спортивных событий, которые стоит увидеть, до обмена реакциями на финал сезона. Amplify Pre-roll объединяет ваш бренд с встроенным видеоконтентом от 200+ премиальных, безопасных для бренда видео-издателей, включая ведущие телевизионные сети, крупные спортивные лиги и профессиональные новостные агентства.Покажите своей аудитории рекламу в начале ролика, которая начинается с интересующих их видео.

Размер файла: Максимальный размер файла — 1 ГБ.

Длина видео: Рекомендуется 15 секунд или меньше. Макс: 2 минуты 20 секунд.

Типы файлов: MP4 или MOV

Соотношение сторон видео: Рекомендуется 1: 1, так как изображение всегда будет отображаться квадратным на настольных и мобильных устройствах, на временной шкале и в профиле. Это и 9:16 (по вертикали) займут столько же недвижимости, что больше, чем 16: 9.

Ваше объявление будет автоматически сопоставляться с контентом издателя с аналогичным соотношением сторон, если он доступен, но мы рекомендуем обратить внимание на тип контента издателя, который вы хотите использовать, и спланировать, чтобы отразить тенденции в соотношении сторон

Рекомендуемый размер видео: 1200 x 1200 (минимум для 1: 1 — 600 x 600)

Если соотношение сторон не 1: 1: минимум 640×360

URL (необязательно): должен начинаться с http: // или https: //

Брендинг: Настоятельно рекомендуется повсюду (помните, что у Amplify Sponsorships есть оверлеи продукта в верхнем левом, нижнем правом и левом углах для предварительного просмотра видео издателя, обратного отсчета рекламы и т. Д.)

Подписи: Настоятельно рекомендуется использовать скрытые субтитры или наложение текста.

Рекомендуемый битрейт видео: 6000–10 000 КБ (рекомендуется 6000 КБ) для 1080p. 5 000–8 000 000 (рекомендуется 5 000 000) для 720p.

Рекомендуемая частота кадров: 29,97 или 30 кадров в секунду. Более высокое приемлемо. Если доступное видео имеет более низкую частоту кадров, не пытайтесь повысить его частоту.

Рекомендация аудиокодека: AAC LC (низкая сложность)

Рекомендация видеокодека: h364, базовый, основной или высокий профиль с цветовым пространством 4: 2: 0.

% PDF-1.6 % 603 0 obj> эндобдж xref 603 89 0000000016 00000 н. 0000003804 00000 н. 0000003886 00000 н. 0000004014 00000 н. 0000004315 00000 н. 0000004979 00000 п. 0000005056 00000 н. 0000005092 00000 н. 0000005139 00000 п. 0000005186 00000 п. 0000005233 00000 п. 0000005280 00000 н. 0000005325 00000 н. 0000005371 00000 п. 0000005416 00000 н. 0000007610 00000 п. 0000007660 00000 н. 0000007712 00000 н. 0000007787 00000 н. 0000008312 00000 н. 0000009482 00000 н. 0000009882 00000 н. 0000014501 00000 п. 0000017405 00000 п. 0000017481 00000 п. 0000017531 00000 п. 0000020024 00000 н. 0000023345 00000 п. 0000023513 00000 п. 0000024893 00000 п. 0000026929 00000 п. 0000027204 00000 п. 0000030647 00000 п. 0000031012 00000 п. 0000031196 00000 п. 0000031312 00000 п. 0000031961 00000 п. 0000032440 00000 п. 0000032514 00000 п. 0000032810 00000 п. 0000033210 00000 п. 0000036982 00000 п. 0000040486 00000 п. 0000040750 00000 п. 0000042195 00000 п. 0000042462 00000 н. 0000042563 00000 н. 0000045687 00000 п. 0000049502 00000 п. 0000053713 00000 п. 0000056123 00000 п. 0000059489 00000 п. 0000059673 00000 п. 0000062044 00000 п. 0000064806 00000 п. 0000065051 00000 п. 0000070265 00000 п. 0000077568 00000 п. 0000080271 00000 п. 0000080455 00000 п. 0000080696 00000 п. 0000084224 00000 п. 0000091452 00000 п. 0000095543 00000 п. 0000095730 00000 п. 0000095950 00000 п. 0000098152 00000 п. 0000108408 00000 н. 0000114326 00000 н. 0000118082 00000 н. 0000174722 00000 н. 0000187025 00000 н. 0000189687 00000 н. 0000192099 00000 н. 0000192585 00000 н. 0000192665 00000 н. 0000192748 00000 н. 0000193703 00000 н. 0000194580 00000 н. 0000197249 00000 н. 0000197329 00000 н. 0000198031 00000 н. 0000198613 00000 н. 0000199129 00000 н. 0000199522 00000 н. 0000199922 00000 н. 0000200316 00000 н. 0000200656 00000 н. 0000002076 00000 н. трейлер ] >> startxref 0 %% EOF 691 0 obj> поток xWiTWof $ H * Z [F ق @ QF4l «@ D @ ܃ B {EpT \ Pj * cOO $ `» ڃ {gy} ~ wo &

Лизат тромбоцитов человека как альтернатива фетальной бычьей сыворотке для культивирования и эндотелиальной дифференцировки мезенхимальных стволовых клеток околоплодных вод человека

Введение

Мезенхимальные стволовые клетки (МСК) рассматриваются как многообещающий инструмент для клеточной терапии.Амниотическая жидкость — источник мезенхимальных стволовых клеток, что вызывает все больший интерес. Человек МСК амниотической жидкости (hAF) можно выделить из околоплодных вод второй триместр беременности путем амниоцентеза, минимально инвазивная процедура. hAF-MSC составляют 0,9–1,5% клеточного популяции в околоплодных водах (1,2). В качестве hAF-MSC могут вызывать остеогенные, хондрогенные, адипогенные, миогенные, эндотелиальные, печеночные или нейрогенные клоны (3), они показали свою эффективность в лечение многих заболеваний (4).Из-за эндотелиальной дифференцировки потенциал МСК, они получили значительное количество внимание как аутологичный источник клеточной терапии в восстановление эндотелиальных функций и содействие васкуляризации (5,6).

В процессе выращивания изоляция и протоколы расширения используют FBS в качестве дополнения, поскольку она использовалась в несколько клинических испытаний (7). В то время как FBS содержит различные факторы роста, гормоны и питательные вещества. (8), он также обладает высокой эндотоксина и может быть потенциальным источником микробного загрязнители, включая грибы, бактерии, вирусы и прионы.Таким образом, клинические испытания и будущее терапевтическое применение МСК человека Следует стремиться избегать использования сывороток животного происхождения (9). Исследования вызвали обеспокоенность по поводу возможность передачи патогенов животным во время культивирования и процессы трансплантации (7,10). Кроме того, сообщалось, что пациенты, получившие при трансплантации клеток с МСК, увеличенными в FBS, обнаруживаются антитела против бычьих антигенов (11). Поэтому в качестве альтернативы использованию FBS для обеспечения питательными веществами и роста факторы (12).

Лизат тромбоцитов человека (hPL) был предложен в качестве альтернатива животной сыворотке для распространения МСК в vitro (13). hPL содержит различные факторы роста, включая фактор роста тромбоцитов (PDGF), трансформирующий фактор роста (TGF) и рост эпидермиса фактор (EGF) (11). Этот рост было показано, что факторы увеличивают скорость пролиферации МСК и сохраняют свой потенциал многолинейной дифференциации при культивирование в отсутствие ФБС (9). Биоактивные молекулы и факторы роста содержащиеся в hPL, как было показано, поддерживают расширение MSC происходит из костного мозга (КМ) (12), пуповинной крови (14) и жировой ткани (10).Кроме того, сообщалось о hPL. для индукции эндотелиальной дифференцировки BM-MSC (15).

На основании соответствующих данных (9,10,12,14,15), В настоящем исследовании изучалось использование FBS или hPL в качестве добавка для клеточных культур и сравнили характеристики hAF-MSC в этих условиях. Настоящее исследование сосредоточено на потенциал эндотелиальной дифференцировки AF-MSC, когда они были индуцированный фактором роста эндотелия сосудов (VEGF) с добавлением с FBS или hPL.

Материалы и методы
Подготовка тромбоцитов человека лизат

Человеческие донорские тромбоциты (n = 15) были получены из банк крови больницы Махарадж Накорн Чиангмай с использованием тромбоцитов метод афереза ​​после положительного скрининга на антитела к эритроцитам.Впоследствии hPL был подготовлен в соответствии с ранее описанный метод (8). Вкратце, 15 объединенные группы тромбоцитов замораживали при -80 ° C, а затем оттаивали при 37 ° С; это повторилось трижды. Для удаления фрагментов мембраны, лизат центрифугировали при 2200 × g при комнатной температуре в течение 20 мин и супернатант фильтровали через фильтр 0,2 мкм. (Corning Inc.). Аликвоты лизата тромбоцитов хранили в −20 ° С. Чтобы избежать образования геля hPL, 2 Ед / мл гепарина (LEO Pharma A / S) был добавлен как антикоагулянт.

Анализ жизнеспособности клеток МТТ

MTT (каталожный номер 298-93-1; Sigma-Aldrich; Merck KGaA) был использован для оценки оптимальных концентраций hPL. hAF-MSC высевали в 96-луночный планшет по 5 × 103 клеток в повторить трижды и инкубировать при 37 ° C с 5% CO2 и 95% влажность в течение 24 ч. Клетки культивировали с DMEM с высоким содержанием глюкозы. (Gibco; Thermo Fisher Scientific, Inc.) с добавлением hPL (2,5, 5, 10, 20 или 40%) на 24, 48 или 72 часа. В качестве контроля клетки были культивированные только с DMEM, не содержащие ни FBS, ни hPL.На в указанные временные точки среда была удалена и заменена на МТТ раствор (0,5 мг / мл в DMEM). Еще через 4 часа инкубации в тех же условиях, что и для культивирования, раствор МТТ удаляли и добавляли 100 мкл ДМСО для растворения кристаллов формазана. В поглощение определяли при 540 нм с помощью спектрофотометра.

Подготовка клеток и культивирование

Образцы клеток околоплодных вод человека с нормальным кариотип был получен в течение 16–22 недель беременности от Лаборатория генетики человека кафедры анатомии факультета Медицина, Университет Чиангмая.Это исследование было одобрено Комитет по этике исследований медицинского факультета, Чиангмай Университет 13 марта 2018 г. (№ ANA-2561-05343).

Собранные клетки культивировали с BIOAMF-3 ™. Полная среда (биологическая промышленность) площадью 25 см2 колба для культивирования (Corning Inc.) при 37 ° C, 5% CO2 и 95% влажность в течение 9 дней в лаборатории генетики человека для повседневной пренатальная диагностика. После получения клеток среду удаляли, и клетки промывали стерильным PBS. Они тогда были отсоединился от колбы с 0.25% трипсин-ЭДТА (Gibco; Thermo Fisher Scientific, Inc.) и культивировали в основной питательной среде: DMEM-высокий уровень глюкозы с гентамицином, пенициллином и стрептомицином, и с добавлением FBS (каталожный номер 16000036; Gibco; Thermo Fisher Scientific, Inc.) или hPL. Добавлена ​​основная питательная среда. с 10% FBS, 10% hPL или 20% hPL. Плотность клеток каждого группа была доведена до 105 клеток / см2 в колба для культивирования. Затем клетки инкубировали при 37 ° C, 5% CO2. и 95% влажности. Среду меняли каждые 3 дня.На достигнув 80% слияния, адгезивные клетки пассажа 1 были отделены с использованием 0,25% трипсина-ЭДТА. Определение пролиферации клеток и характеристика была выполнена после двух пассажей.

Клеточная пролиферация

hAF-МСК высевали на 24-луночный планшет (Corning Inc.) при плотности 104 кл. / См2. Они затем культивировали в основной среде с 10% FBS, 10% hPL или 20% hPL (10% FBS использовался в качестве контроля в этом эксперименте) при 37 ° C, 5% CO2 и 95% влажность. Подсчет клеток в сутки 0 и 1 день, а затем каждый второй день до 21 дня после посева с помощью гемоцитометра.

Проточная цитометрия

Для характеристики hAF-MSC маркеры клеточной поверхности клеток, культивируемых в основной среде, содержащей 10% FBS или 10% hPL, были оценен. Клетки трипсинизировали 0,25% трипсином-ЭДТА при 37 ° C в течение 1 мин и центрифугирование при 2035 × g в течение 6 мин при комнатной температуре. температура для получения гранул клеток. Затем неспецифическое связывание блокировали с использованием 10% человеческой сыворотки AB [сыворотка от доноров типа AB; обработано в нашей лаборатории и инактивировано при 53 ° C в течение 90 мин как описано ранее (16)] при 4 ° C на 30 мин.Впоследствии их инкубировали со следующими моноклональные антитела: мышиные антитела против CD34-FITC человека (номер по каталогу 343504; BioLegend, Inc.), CD44-FITC (номер по каталогу 21810443; ImmunoTools GmbH), CD45-фикоэритрин (PE; каталожный номер 304008; BioLegend, Inc.), CD73-PE (№ по каталогу 21270734; ImmunoTools GmbH), HLA-ABC-FITC (№ по каталогу. 21159033; ImmunoTools GmbH) и HLA-DR-PE (номер по каталогу 21388994; ImmunoTools GmbH). Обнаружена экспрессия маркеров клеточной поверхности. с помощью FACScan (BD Biosciences) и проанализировали с помощью CellQuest ™ Pro 9.0 (BD Biosciences).

Дифференциация hAF-MSC в эндотелиальные клетки

Для исследования дифференцировки эндотелия потенциал hAF-MSC, клетки высевали в основную среду с добавлением 10% FBS или 10% hPL при плотности 104 клеток / см2 в 24-луночном планшете и индуцировали VEGF (кат. нет. V7259; Сигма-Олдрич; Merck KGaA) на 14 дней. Они тогда были субкультивировать на две группы и культивировать в основных средах с добавлением 10% FBS и 50 нг / мл VEGF или 10% hPL и 50 нг / мл VEGF (n = 5).

Количественная обратная транскрипция (RT-q) ПЦР

Суммарная РНК клеток (неиндуцированная с добавлением FBS клетки, неиндуцированные клетки с добавлением hPL, индуцированные с добавлением FBS клетки и индуцированные клетки, дополненные hPL; n = 5) был извлечен с использованием набор для выделения мини-РНК Illutra RNAspin (GE Healthcare Life Наук). Затем была проведена первая цепь комплементарной ДНК (кДНК). синтезируется из тотальной РНК с использованием набора для синтеза кДНК Tetro (кат. нет. БИО-65043; Биолайн), согласно заводской инструкции.Вкратце, образцы инкубировали при 45 ° C в течение 30 мин, затем 85 ° C в течение 5 минут для прекращения реакции. Ген транскрипты измеряли с помощью SensiFAST ™ SYBR® Комплект No-ROX (номер по каталогу BIO-98005; Bioline) с 7500 Fast Real-Time Система ПЦР (Applied Biosystems; Thermo Fisher Scientific, Inc.). Праймеры для ПЦР, нацеленные на фактор фон Виллебранда (vWF), рецептор 2 VEGF (VEGFR2) и эндотелиальная синтаза оксида азота (eNOS). (Таблица I) (17). Протокол состоял из 36 циклов. 30 секунд денатурации при 95 ° C, 30 секунд отжига при 60 ° C и 60 секунд удлинения при 72 ° C.GAPDH использовался в качестве внутреннего контроля. Уровень экспрессии генов, специфичных для эндотелия, был нанесен на график. методом 2 − ΔΔCq (18).

Таблица I.

Праймерные последовательности обратного транскрипционно-количественная ПЦР.

Таблица I.

Праймерные последовательности обратного транскрипционно-количественная ПЦР.

Праймер Последовательность
vWF
Вперед 5′-3 ′ CAAGGAAGAAAATAACACAGGTGAA
Реверс 5′-3 ′ TCATTGACCTTGCAGAAGTGAGTAT
VEGFR2
Вперед 5′-3 ′ GACTTCCTGACCTTGGAGCATCT
реверс 5′-3 ′ GATTTTAACCACGTTCTTCTCCGA
eNOS
Вперед 5′-3 ′ TCCCCCAGAACTCTTCCTT
реверс 5′-3 ′ CTCATTCTCCAGGTGCTTCA
GAPDH
Вперед 5′-3 ′ ATGGGGAAGGTGAAGGTCG
Реверс 5′-3 ′ TAAAAGCAGCCCTGGTGACC
Иммунофлуоресценция

Клетки из всех состояний (неиндуцированные и индуцированные клетки с добавкой FBS или hPL; n = 5) были проанализированы для экспрессия специфичных для эндотелия маркеров (vWF, VEGFR2 и eNOS).Вкратце, клетки дважды промывали PBS и фиксировали 4% параформальдегид при комнатной температуре в течение 15 мин. Они тогда были проницаемость 0,2% Triton X-100 (Amresco, LLC) в PBS в помещении температура в течение 10 мин. Затем блокирование неспецифического связывания было проведено с 10% сывороткой AB человека в 1% BSA-PBS в течение 30 мин в комнате температура с последующей инкубацией с мышиным моноклональным антителом против человеческого vWF (номер по каталогу MA5-14029; Pierce; Thermo Fisher Scientific, Inc.), кроличьи моноклональные антитела против человеческого VEGFR2. (Кот.нет. MA5-16417; Пирс; Thermo Fisher Scientific, Inc.) или мышиные моноклональные антитела против eNOS (номер по каталогу MA5-15559; Pierce; Thermo Fisher Scientific, Inc.) при 37 ° C в течение 2 ч при разбавлении 1: 200. После двукратной промывки клеток PBS конъюгированная с FITC коза антитело против IgG мыши (номер по каталогу 62-6511; Thermo Fisher Scientific, Inc.) или козьих антител против кроличьего IgG, конъюгированных с PE. (каталожный номер P-2771MP; Thermo Fisher Scientific, Inc.) были добавлены и инкубируют при 37 ° С в течение 1 ч при разведении 1: 500. Для ядерной При окрашивании клетки инкубировали с антифадом DAPI (2 мкл) в течение 10 мкл. мин при комнатной температуре (Invitrogen; Thermo Fisher Scientific, Inc.). Образцы были исследованы с использованием флуоресцентной лампы Olympus AX70. микроскоп и изображения были получены с помощью DP Manager и DP контроллер (увеличение × 20; Olympus Corporation). Статистическая анализ флуоресцентных сигналов проводился с помощью ImageJ 1.50i программное обеспечение (Национальные институты здравоохранения).

Формирование сети

Потенциал формирования сети оценивался инкубирование клеток из всех условий (неиндуцированных и индуцированных клетки с добавкой FBS или hPL; n = 5) в росте Матригеля матрица базальной мембраны с пониженным фактором (Corning Inc.), согласно согласно инструкции производителя. Вкратце, Матригель разморозили в 4 ° C в течение ночи и добавляли в 96-луночный планшет в концентрации 50 мкл / см2 с предварительно охлажденными наконечниками пипеток. Далее пластина была инкубируют при 37 ° C в течение 30 мин. После приготовления клеток клетки были подсчитали, и концентрацию довели до 2 × 105 клеток / 100 мкл. Затем клетки добавляли с выбранной плотностью к покрытые гелем лунки и инкубировали при 37 ° C, 5% CO2 и Влажность 95% в течение 24 часов. Эндотелиальная клетка пупочной вены человека (HUVEC) линия (Gibco; Thermo Fisher Scientific, Inc.) использовался как положительный контроль. Формирование сети наблюдалось под светом. микроскоп (увеличение × 20). Анализатор ангиогенеза ImageJ (http://image.bio.methods.free.fr/ImageJ/?Angiogenesis-Analyzer-for-ImageJ) был использован для анализа общей площади сетки и номера сетки.

Статистический анализ

Данные представлены как среднее значение ± стандартная ошибка среднее (n = 5 для всех экспериментов). Статистические сравнения были выполнено трижды с использованием теста Краскела-Уоллиса с апостериорным Тест Данна или U-критерий Манна-Уитни.Статистический анализ был выполняется с помощью программного обеспечения SPSS версии 22.0 (IBM Corp). P <0,05 считалось показателем статистически значимого разница.

Результаты
Анализ жизнеспособности клеток с помощью МТТ анализ

hAF-MSC культивировали в основных средах с добавками с hPL 2,5, 5, 10, 20 или 40% в течение 24, 48 и 72 часов. Результаты, достижения указали на увеличение жизнеспособности клеток по сравнению с контролем при все моменты времени. Жизнеспособность клеток через 72 часа была значительно увеличена. по сравнению с 24 и 48 часами во всех условиях эксперимента, за исключением контрольного лечения (P <0.05; Рисунок 1).

Морфология hAF-MSC

При микроскопии установлено, что на 2 пассаже hAF-MSC, культивируемые в основных средах с добавлением 10% FBS, 10% hPL или 20% hPL плотно прилипли к колбе в монослое и имели гомогенную фибробластоподобную морфологию (рис. 2).

Пролиферация hAF-MSC

Кривая роста показывает, что количество клеток в каждое состояние (рис. 3) увеличивалось непрерывно в фазе регистрации без существенной разницы между условиями.Клетки с добавлением 10% FBS и 10% hPL вошли в стационарную фазу без существенных отличий в номере ячейки. Однако клетки с добавлением 20% hPL показали уменьшение количества ячеек между 11 и 15 днями. Меньшее количество ячеек поддерживалась между 13 и 21 днями.

Анализ экспрессии клеток поверхностные маркеры методом проточной цитометрии

Проточная цитометрия использовалась для характеристики экспрессия маркеров клеточной поверхности в hAF-MSC. Результаты, достижения показали, что экспрессия маркеров клеточной поверхности не различается. между клетками, культивируемыми в среде с добавлением 10% FBS, и 10% Носители с добавлением hPL.HAF-MSC из этих двух групп были положительный по CD44, CD73 и HLA-ABC, маркерам клеточной поверхности, которые экспрессируются hAF-MSC и отрицательны по CD34, CD45 и HLA-DR (Рис.4).

Морфология индуцированных hAF-MSC
Было индуцировано

hAF-MSC и разделено на две группы. (базовая среда с добавлением 10% FBS и 50 нг / мл VEGF или базовая среда среды с добавлением 10% hPL и 50 нг / мл VEGF). Через 14 дней воздействия VEGF в среде с добавлением 10% FBS или 10% hPL, оба набора клеток имели форму веретена.Однако овальный в окружающих прилипших клетках появились круглые пространства. hAF-MSC, культивированные в среде с добавлением hPL (фиг. 5).

Обнаружение гена, связанного с эндотелием выражение

Через 14 дней индукции VEGF экспрессия генов, связанных с эндотелием, включая vWF, VEGFR2 и eNOS, было определяли с помощью RT-qPCR (фиг. 6). Результаты показали, что уровни экспрессии vWF (фиг. 6A), VEGFR2 (фиг. 6B) и eNOS (фиг. 6C) были увеличены в Индуцированные клетки с добавлением FBS по сравнению с неиндуцированным контролем клетки, культивированные в среде с добавлением FBS (2.66-кратный, 2,10-кратный и В 1,73 раза соответственно). Точно так же уровни этих генов были увеличено в индуцированных клетках, содержащих hPL, по сравнению с неиндуцированные контрольные клетки, культивируемые в среде с добавлением hPL (3,93 раза, 2,94 раза и 2,30 раза соответственно). Более того, уровни экспрессии vWF, VEGFR2 и eNOS были увеличился в большей степени в индуцированных клетках, которые были культивировали с 10% hPL по сравнению с клетками, которые были культивированы с 10% FBS.

Экспрессия специфических для эндотелия маркеры

Была проанализирована экспрессия vWF, VEGFR2 и eNOS. как в индуцированных, так и в неиндуцированных условиях.Результат Иммунофлуоресцентный анализ показал, что индуцированные клетки культивировали либо с FBS, либо с hPL, экспрессирующими vWF, VEGFR2 и eNOS. Напротив, для этих белков в неиндуцированные условия при культивировании в средах с добавлением либо FBS, либо hPL (рис. 7A). Анализ с использованием программного обеспечения ImageJ 1.50i был использован для расчета скорректированная общая флуоресценция клеток (CTCF). Данные показали, что были значительные различия в уровнях CTCF для vWF (фиг. 7B), VEGFR2 (фиг. 7C) и eNOS (фиг.7D) между неиндуцированным и индуцированные клетки при культивировании с FBS или hPL. Анализ CTCF не выявили заметных различий между индуцированными клетками, культивированными в Среда с добавлением FBS или hPL (фиг. 7B-D).

Рис. 7.

Обнаружение экспрессии эндотелиальные маркеры с использованием иммунофлуоресценции. Неиндуцированные клетки с добавлением FBS, неиндуцированные с добавлением hPL клетки, индуцированные клетки с добавлением FBS и индуцированные с добавлением hPL клетки окрашивали антителами против vWF, VEGFR2 или eNOS.Ядра клеток окрашивали DAPI (увеличение × 20; шкала 100 мкм). (A) Типичные изображения клеток, окрашенных на vWF, VEGFR2 и eNOS. Количественная оценка флуоресцентных сигналов с использованием скорректированных общая клеточная флуоресценция (B) vWF, (C) VEGFR2 и (D) eNOS. В U-критерий Манна-Уитни был использован для анализа результатов этого эксперимент * P <0,05. hPL, лизат тромбоцитов человека; vWF, фон Фактор Виллебранда; VEGFR2, фактор роста эндотелия сосудов рецептор 2; Эндотелиальная синтаза оксида азота eNOS.

Умение формировать сети

Образование сетей наблюдали с помощью светового микроскоп после инкубации клеток в планшетах, покрытых матригелем, для 24 ч.Неиндуцированные клетки как в условиях FBS, так и в условиях hPL не представляли сетевую структуру, в то время как Индуцированные клетки с добавлением FBS продемонстрировали некоторую связь с клеточные процессы. Интересно, что индуцированные hPL-клетки показали формирование сети, которая была похожа на HUVEC (рис. 8A). Количественные данные были анализировали анализатором ангиогенеза, программное обеспечение ImageJ 1.50i. Данные представлены в виде общей площади ячеек (рис. 8B) и числа ячеек (рис. 8C) в индуцированных FBS-дополнениях. клетки, индуцированные клетки с добавлением hPL и HUVEC.В Тест Краскела-Уоллиса и апостериорный анализ показали, что количественная оценка двух параметров между тремя группами была обнаружена быть значительным.

Обсуждение

МСК были использованы в клеточной терапии для лечения или восстановить поврежденную ткань (4). Амниотическая жидкость является источником МСК, в которых клетки могут быть изолированы и легко расширяются (19). Хотя FBS широко используется для культивирования МСК, этот метод культивирования вызывает опасения по поводу потенциал передачи ксеногенного белка от сыворотки животного происхождения (13).Этот В настоящем исследовании изучались объединенные hPL в качестве замены FBS в культуральные среды hAF-MSC, с акцентом на потенциал hAF-МСК подвергаются эндотелиальной дифференцировке. ГПЛ была получен из концентрата тромбоцитов с помощью стандартизованных тромбоцитов метод афереза, обеспечивающий высокую концентрацию тромбоцитов и низкий уровень лейкоцитарной контаминации (20). Оптимальная концентрация hPL была оценивается с помощью теста МТТ. Результаты выявили значительные различия после культивирования hAF-MSC в среде с добавлением hPL на 72 ч; однако существенной разницы в показателях жизнеспособность клеток при каждой концентрации.На основании этих данных 10 и 20% hPL были выбраны для исследования мезенхимальных характеристики hAF-MSC.

Культура hAF-MSC со средами с добавлением 10% FBS, 10% hPL или 20% hPL выявили фибробластоподобную морфологию, в соответствии с предыдущими исследованиями (10,11,21). Настоящее исследование показало, что культивирование hAF-MSC в течение 21 дня в средах с 10% FBS или 10% hPL не выявили значимых различия в возможностях распространения. Тем не мение, способность к пролиферации снижалась в клетках, культивируемых с 20% hPL; этот результат не соответствовал предыдущему исследованию (22).Это может указывать на вариации в компоненты hPL между партиями. Исследования показали, что есть многие факторы роста, содержащиеся в hPL, способствуют развитию МСК пролиферация и дифференцировка, включая основные фибробласты фактор роста (bFGF), EGF, инсулиноподобный фактор роста 1 (IGF-1), PDGF, VEGF и TGF-β (7,9,23). Как сообщалось в предыдущих исследованиях, hPL часто используется в концентрация 10% (9,24,25). Следовательно, эта концентрация была выбрана для оценки MSC. характеристики. Результаты экспериментов по проточной цитометрии показали, что hAF-MSC, культивированные с 10% FBS или 10% hPL, имели аналогичный уровень экспрессии маркеров клеточной поверхности.Данные представленные здесь, указывают на то, что добавление сред с hPL может поддерживать характеристики роста и фенотипический профиль hAF-МСК (26). Поэтому там возможность использования hPL вместо FBS в доклинические применения.

По свойствам МСК они способны дифференцировать согласно их мезодермальному происхождению. Предыдущий исследования показали возможность дифференциации hAF-MSC в остеоциты и хондроциты (27,28). В настоящем исследовании hAF-MSC, индуцированные с использованием VEGF, когда культивированные на средах с добавлением hPL были способны к эндотелиальному дифференциация.После 14 дней стимуляции VEGF hAF-MSC проявляли характеристики, подобные эндотелию. Индуцированная клетки, культивируемые в среде с добавлением FBS, плотно прилипали с фибробластоподобной морфологией. Напротив, клетки, культивированные в СМИ дополненных hPL отображаются разные аранжировки, согласуется с другим исследованием (29). Анализ экспрессии генов с использованием RT-qPCR также продемонстрировала, что vWF, VEGFR2 и eNOS были экспрессированы. в индуцированных клетках, культивируемых в средах с добавлением FBS или hPL на более высоких уровнях, чем в неиндуцированных клетках.Более того, данные показали, что клетки культивировали с hPL и индуцировали с VEGF показали более высокий уровень экспрессии, чем индуцированные клетки культивировали с FBS. Эти результаты были дополнительно исследованы с использованием иммунофлуоресцентный анализ. Этот анализ показал, что там были специфические белки, экспрессируемые в индуцированных клетках, культивированных с FBS или hPL. Эти результаты согласуются с предыдущим исследованием, в котором сообщили, что hPL может индуцировать экспрессию эндотелиальных маркеров (15). Лизат тромбоцитов был идентифицирован как мощный фактор индукции, потому что он содержит различные факторы роста, влияющие на созревание эндотелиальных клеток и рост (15).Это было сообщили, что VEGF и ангиопоэтин-1 в hPL стимулируют AKT путь, способствующий выживанию клеток и развитию сосудов в сердечно-сосудистая функция (30). Исследования также показали, что добавление в среду IGF-1, EGF и bFGF могут усиливать дифференцировку эндотелия потенциал индуцированных клеток (31–33).

Настоящее исследование также указывает на то, что индуцированное hAF-MSC могут формировать сети на Матригеле. Добавленные hPL индуцированные клетки сформировали сетевую структуру, которая были сопоставимы с таковыми, сформированными HUVEC.Это предполагает, что Факторы роста, выделяемые тромбоцитами, могут способствовать ангиогенезу in vitro. Исследования показали, что hPL индуцирует васкулогенные и ангиогенные реакции при формировании эндотелиальных колоний клетки, опосредованные факторами роста, включая VEGF, bFGF и PDGF, приводя к образованию капиллярной сети (30,34). Ангиогенные эффекты могут быть активированы через путь ERK1 / 2 и путь ангиопоэтин-1 / Tie2 в ответ на уровень VEGF (35). Более того, эффект hPL обработка эндотелиальных клеток может стимулировать путь ERK1 / 2 к улучшают заживление ран, разрастание клеток и рост сосудов (36).Данные в настоящем исследования показывают, что hPL играет роль в дифференцировке hAF-MSC, поскольку они проявляли некоторые специфичные для эндотелия маркеры (vWF, VEGFR2 и eNOS) и образовывали капиллярные структуры. Следовательно, использование объединенного hPL может применяться в подходах, не содержащих ксеногенов. и стратегии улучшения васкуляризации.

Ограничением настоящего исследования является требование для получения дополнительной информации о концентрации факторов роста в hPL. Идентификация и количественная оценка различного роста факторов в hPL с помощью ELISA необходимо.Эффект от другого роста факторы, которые могут взаимодействовать с VEGF, также следует учитывать. В Кроме того, следует проводить более широкий профиль экспрессии. это также важно определить факторы и их концентрацию, присутствует в FBS и hPL. Наконец, также важно выяснить роль специфических факторов роста в эндотелиальном путь дифференцировки.

В заключение, настоящее исследование продемонстрировало что hAF-MSC можно культивировать в среде с добавлением hPL, в то время как поддержание пролиферации и иммунного фенотипа, а также увеличение потенциала дифференцировки эндотелия.Это говорит о том что hPL может использоваться как альтернатива FBS. hPL также связаны с высокой степенью безопасности при использовании в клинических условиях разложение клеток и лечение сосудистых заболеваний.

Благодарности

Все клетки околоплодных вод человека были предоставлены Лаборатория генетики человека, Департамент анатомии и Таиланда Центр передового опыта в области тканевой инженерии и стволовых клеток, отделение биохимии медицинского факультета Чиангмайского университета. В Авторы выражают благодарность банку крови Махараджа Накорна Чанга. Больница Май для поставки концентратов тромбоцитов.

Финансирование

Это исследование финансировалось Медицинским факультетом, Университет Чиангмая, Чиангмай, Таиланд (грант № ANA-2561-05343).

Наличие данных и материалов

Все данные, полученные или проанализированные в ходе этого исследования, включены в эту опубликованную статью.

Авторские взносы

WT и SA разработали эксперименты, а PP разработал эксперименты. KB, CP и NP внесли существенный вклад в дизайн исследования.SN проанализировал и интерпретировал данные. RM и TL собрали и проанализировали данные. КТ выполнила эксперименты. Документ был составлен WT, а рукопись была одобрено всеми авторами.

Утверждение этических норм и согласие на участвовать

Письменное информированное согласие было получено, и использованный протокол был одобрен этическим комитетом Медицинский факультет Университета Чиангмая, 13 марта 2018 г. ANA-2561-05343).

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересы.

Список литературы

1

Cananzi M, Atala A и De Coppi P: Стебель клетки, полученные из околоплодных вод: новые возможности регенеративного медицина. Репродукция Биомед онлайн. 18 (Дополнение 1): S17 – S27. 2009 г. Просмотр статьи: Google Scholar

2

Антонуччи I, Ступпия Л., Канеко Ю., Ю С, Тадзири Н., Бэ Е.К., Чхеда С.Х., Вайнбрен Н.Л. и Борлонган CV: амниотические жидкость как богатый источник мезенхимальных стромальных клеток для трансплантационная терапия.Трансплантация клеток. 20: 789–795. 2011 г. Просмотр статьи: Google Scholar: PubMed / NCBI

3

Чжоу Дж., Ван Д, Лян Т., Го Кью и Чжан G: Мезенхимальные стволовые клетки, полученные из околоплодных вод: характеристики и терапевтические приложения. Arch Gynecol Obstet. 290: 223–231. 2014. Просмотреть статью: Google Scholar: PubMed / NCBI

4

Вэй Х, Ян Х, Хань З.П., Цюй Ф., Шао Л. и Ши Ю.Ф .: Мезенхимальные стволовые клетки: новая тенденция в клеточной терапии.Acta Pharmacol Sin. 34: 747–754. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

5

Лю Дж. В., Дюнуайе-Гендр С., Серр-Бинье V, Mai G, Lambert JF, Fish RJ, Pernod G, Buehler L, Bounameaux H и Kruithof EK: Характеристика эндотелиально-подобных клеток, полученных из мезенхимальных стволовых клеток человека. J Thromb Haemost. 5: 826–834. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

6

Лидун Г., Шаоцин Л., Юньфан В., Хуэйминь Ю. Дацин Л., Лицзюань Х., Цысянь Б., Фанг Y и Сюэ Н.: In vitro. дифференцировка мезенхимальных стволовых клеток человека, полученных из жировой ткани в эндотелиально-подобные клетки.Chin Sci Bull. 51: 1863–1868. 2006 г. Просмотр статьи: Google Scholar

7

Витценедер К., Линденмайр А., Габриэла С., Höllera K, Theißa D, Redlb H и Hennerbichler S: человеческое происхождение альтернативы фетальной телячьей сыворотке в культуре клеток. Трансфус Мед Мать. 40: 417–423. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

8

Раух Ч., Фейфель Э., Аманн Э.М., Шпётль Х.П., Schennach H, Pfaller W и Gstraunthaler G: альтернативы использованию фетальной бычьей сыворотки: лизаты тромбоцитов человека в качестве заменителя сыворотки в средах для культивирования клеток.АЛЬТЕКС. 28: 305–316. 2011. Просмотр статьи: Google Scholar: PubMed / NCBI

9

Хемеда Х., Гибель Б. и Вагнер В.: Оценка лизата тромбоцитов человека по сравнению с фетальной бычьей сывороткой для культура мезенхимальных стромальных клеток. Цитотерапия. 16: 170–180. 2014. Просмотреть статью: Google Scholar: PubMed / NCBI

10

Naaijkens B, Niessen HW, Prins HJ, Krijnen PA, Kokhuis TJ, de Jong N, Van Hinsbergh VW, Kamp O, Helder MN, Musters RJ и др.: Лизат тромбоцитов человека в виде фетальной бычьей сыворотки. заменитель улучшает культуру стромальных клеток, полученных из жировой ткани человека, для будущие приложения для восстановления сердца.Cell Tissue Res. 348: 119–130. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

11

Антонинус А.А., Вдовати В., Виджая Л., Агустина Д., Пурадишастра С., Сумитро С.Б., Видодо М.А. и Бахтияр I. Лизат тромбоцитов человека усиливает распространение вируса Уортона. мезенхимальные стволовые клетки, полученные из студня. Биомаркеры Genomic Med. 7: 87–97. 2015. Просмотр статьи: Google Scholar

.

12

Бибак К., Хеккер А., Коджаомер А., Ланнерт H, Schallmoser K, Strunk D и Klüter H: Человеческие альтернативы фетальная бычья сыворотка для размножения мезенхимальных стромальных клеток из костного мозга.Стволовые клетки. 27: 2331–2341. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

13

Дусет К., Эрноу И., Чжан Ю., Лленсе-младший, Begot L, Holy X и Lataillade JJ: лизаты тромбоцитов способствуют Экспансия мезенхимальных стволовых клеток: безопасный заменитель животных сыворотка в приложениях клеточной терапии. J. Cell Physiol. 205: 228–236. 2005. Просмотр статьи: Google Scholar: PubMed / NCBI

14

Аванзини М.А., Бернардо М.Э., Комета А.М., Perotti C, Zaffaroni N, Novara F, Visai L, Moretta A, Del Fante C, Вилла Р. и др.: Создание мезенхимальных стромальных клеток в присутствие лизата тромбоцитов: фенотипическое и функциональное сравнение предшественников из пуповинной крови и костного мозга.Haematologica. 94: 1649–1660. 2009. Просмотр статьи: Google Scholar: PubMed / NCBI

15

Хомаюни Могхадам Ф, Тайеби Т., Моради А, Надри Х, Барзегар К. и Эслами Г. Лечение лизатом тромбоцитов индуцирует эндотелиальную дифференцировку мезенхимального ствола костного мозга клетки под жидким напряжением сдвига. ИСКЛЮЧЕНИЕ J. 13: 638–649. 2014.PubMed / NCBI

16

Солтис Р.Д., Хас Д., Моррис М.Дж. и Уилсон ID: Влияние тепловой инактивации сыворотки на агрегацию иммуноглобулины.Иммунология. 36: 37–45. 1979. PubMed / NCBI

17

Танчароен В., Аунгсучаван С., Потачароен П, Маркми Р., Наракорнсак С., Киоди Дж., Бунма Н. и Тасуя В.: Дифференциация мезенхимальных стволовых клеток из околоплодных вод человека эндотелиальным клеткам сосудов. Acta Histochem. 119: 113–121. 2017 г. Просмотр статьи: Google Scholar: PubMed / NCBI

18

Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2 (-Delta Delta C (T)).Методы. 25: 402–408. 2001 г. Просмотр статьи: Google Scholar: PubMed / NCBI

19

Фэй Х, Цзян С, Чжан С, Ли И, Ге Дж, Хэ Б, Гольдштейн С. и Руис Г.: изоляция, культура и идентификация мезенхимальные стволовые клетки, полученные из околоплодных вод. Cell Biochem Биофиз. 67: 689–694. 2013. Просмотр статьи: Google Scholar: PubMed / NCBI

20

Наску М.С., Самнер С.М., Чокалло А, Кемелмахер Х., Торесен М., Копленд I, Галипо Дж. И Перони Дж. Ф .: Лизат тромбоцитов как новая бессывороточная добавка к средам для культура мезенхимальных стволовых клеток, полученных из костного мозга лошадей.Корень Cell Res Ther. 9: 752018. Просмотр статьи: Google Scholar: PubMed / NCBI

21

Schallmoser K, Bartmann C, Rohde E, Райниш А., Кашофе К., Штадельмейер Э., Дрекслер К., Ланцер Г., Линкеш W и Strunk D: лизат тромбоцитов человека может заменить эмбрион крупного рогатого скота сыворотка для расширения функциональных мезенхимальных стромальные клетки. Переливание. 47: 1436–1446. 2007. Просмотр статьи: Google Scholar: PubMed / NCBI

22

Фекете Н, Гаделорге М, Фюрст Д., Маурер С, Даузенд Дж., Флери-Каппельессо С., Майлендер В., Лотфи Р., Игнатий А., Sensebé L и др.: Объединенный лизат тромбоцитов из цельной крови. концентраты тромбоцитов и концентраты тромбоцитов, полученные из афереза для выделения и расширения мезенхимальных клеток костного мозга человека стромальные клетки: производственный процесс, содержание и идентификация активные компоненты.Цитотерапия. 14: 540–554. 2012. Просмотр статьи: Google Scholar: PubMed / NCBI

23

Burnouf T, Strunk D, Koh MB и Schallmoser K: лизат тромбоцитов человека: замена фетальной бычьей сыворотки как золотой стандарт размножения человеческих клеток? Биоматериалы. 76: 371–387. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

24

Лыков А.П., Бондаренко Н.А., Суровцева М.А., Ким И.И., Повещенко О.В., Покушалов Е.А., Коненков В.И.: Сравнительный анализ. эффекты обогащенной тромбоцитами плазмы, лизата тромбоцитов и теленка плода сыворотка на мезенхимальных стволовых клетках.Bull Exp Biol Med. 163: 757–760. 2017. Просмотр статьи: Google Scholar: PubMed / NCBI

25

Ломанн М., Валенда Дж., Хемеда Х., Юссен С., Дрешер В., Джокенховель С., Хатшенройтер Дж., Зенке М. и Вагнер В. Возраст донора лизата тромбоцитов человека влияет на пролиферацию и дифференцировка мезенхимальных стволовых клеток. PLoS One. 7: e378392012. Просмотр статьи: Google Scholar: PubMed / NCBI

26

Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop DJ и Horwitz E: Минимальные критерии для определения мультипотентности мезенхимальные стромальные клетки.Международное общество сотовой связи заявление о терапевтической позиции. Цитотерапия. 8: 315–317. 2006 г. Просмотр статьи: Google Scholar: PubMed / NCBI

27

Наракорнсак С, Повачиранон Н, Peerapapong L, Pothacharoen P и Aungsuchawan S: мезенхимальный стебель клетки дифференцировались в хондроцитоподобные клетки. Acta Histochem. 118: 418–429. 2016. Просмотреть статью: Google Scholar: PubMed / NCBI

28

Laowanitwattana T, Aungsuchawan S, Наракорнсак С., Маркми Р., Танчароен В., Кеоди Дж., Бунма Н., Тасуя W, Peerapapong L, Pangjaidee N и Pothacharoen P: Остеобластический потенциал дифференциации человеческих околоплодных вод мезенхимальные стволовые клетки в различных условиях культивирования.Acta Histochem. 120: 701–712. 2018. Просмотр статьи: Google Scholar: PubMed / NCBI

29

Бен Азуна Н., Дженхани Ф., Регая З., Беррейс Л., Бен Осман Т., Дюкрок Э. и Доменек Дж.: Фенотипический и функциональные характеристики мезенхимальных стволовых клеток из кости костный мозг: Сравнение культур с использованием разных сред с добавками с лизатом тромбоцитов человека или фетальной бычьей сывороткой. Стволовые клетки Res Ther. 3: 62012. Вид Статья: Google Scholar: PubMed / NCBI

30

Ким Х., Прасайн Н., Вемула С., Феркович М.Дж., Йошимото М., Войтик-Харбин С.Л. и Йодер М.С.: Лизат тромбоцитов человека улучшает выживаемость и васкулогенез ECFC, полученных из пуповинной крови в трехмерных (3D) матрицах коллагена.Microvasc Res. 101: 72–81. 2015. Просмотр статьи: Google Scholar: PubMed / NCBI

31

Джазаери М., Алламе А., Сулеймани М., Jazayeri SH, Kaviani S и Kazemnejad S: Капиллярная сеть образование эндотелиальными клетками, дифференцированными из кости человека мезенхимальные стволовые клетки костного мозга. Iran J Biotechnol. 6: 29–35. 2008.

32

Ганг ЭДжей, Чон Дж.А., Хан С., Ян Кью, Чон СиДжей и Ким Х .: Эндотелиальный потенциал ЯК человека, полученных из крови in vitro. мезенхимальные стволовые клетки.Цитотерапия. 8: 215–227. 2006. Просмотр статьи: Google Scholar: PubMed / NCBI

33

Quirici N, Soligo D, Caneva L, Servida F, Bossolasco P и Deliliers GL: дифференциация и расширение эндотелиальные клетки из CD133 (+) клеток костного мозга человека. Br J Haematol. 115: 186–194. 2001. Просмотр статьи: Google Scholar: PubMed / NCBI

34

Fortunato TM, Beltrami C, Emanueli C, De Банк PA и Pula G: гель лизата тромбоцитов и предшественники эндотелия стимулировать образование микрососудистой сети in vitro: ткань инженерные последствия.Sci Rep.6: 253262016. Просмотр статьи: Google Scholar: PubMed / NCBI

35

Хофбауэр П., Ридл С., Витценедер К., Хильднер F, Wolbank S, Groeger M, Gabriel C, Redl H и Holnthoner W: Человек лизат тромбоцитов — реальный кандидат на замену фетальной телячьей сыворотки в качестве средней добавки для сосудистого и лимфатического эндотелия клетки. Цитотерапия. 16: 1238–1244. 2014. Просмотреть статью: Google Scholar: PubMed / NCBI

36

Barsotti MC, Losi P, Briganti E, Сангинетти Э., Магера А., Аль Каял Т.А., Фериани Р., Ди Стефано Р. и Soldani G: Влияние лизата тромбоцитов на клетки человека, участвующие в разные фазы заживления ран.PLoS One. 8: e847532013. Просмотр статьи: Google Scholar: PubMed / NCBI

Орегон планирует построить самую большую видеоплату в студенческом футболе, новую звуковую систему на стадионе Отзен

EUGENE — Орегон планирует построить самую большую видеоплату в студенческом футболе и новую звуковую систему на стадионе Отзен.

UO Athletics предлагает попечительскому совету университета план новой видеоплаты размером 186 x 66 дюймов и точечной звуковой системы над террасой в Ист-Энде на стадионе Autzen.Проект стоимостью 12 миллионов долларов, который будет финансироваться за счет частных пожертвований, будет одобрен Комитетом по финансам и сооружениям попечительского совета UO в понедельник днем ​​и должен быть завершен в августе, к футбольному сезону 2020 года, который включает сентябрь. 12 домашних матчей со штатом Огайо.

«Атлетический департамент постоянно получает отзывы от преданных футбольных фанатов относительно аудио / визуальных аспектов их опыта на стадионе Отцен», — говорится в проектном предложении. «Аудио / видео услуги являются критически важными компонентами для впечатлений болельщиков.Текущее аудио / видео оборудование и технологии на стадионе Отзен устарели (видеопанели вест-энда 12 лет, и она является второй по возрасту в Pac-12) и не оправдывает ожиданий посетителей. Новые доступные технологии позволят отделу лучше соответствовать этим ожиданиям и сыграют важную роль в дифференциации впечатлений от болельщиков на стадионе Autzen ».

ОБНОВЛЕНИЕ: Комитет по финансам и оборудованию UO одобряет предложение по новой видеоплате на стадионе Autzen

Проект призывает к удалению существующей звуковой системы, которая была установлена ​​в 2002 году и долгое время вызывала гнев фанатов штата Орегон, поскольку а также небольшая видеоплата в северо-восточном углу стадиона, чтобы освободить место для новой опорной конструкции, звуковой системы с точечным источником звука и колоссальной видеоплаты, на которой также будет установлена ​​отдельная видеоплата размером 47 x 26 футов, обращенная к стадиону Autzen. которые будут «использоваться в дни мероприятий для общения и развлечения посетителей.«Существующая видеоплата в зоне Вест-Энда, последняя модернизированная в 2008 году, также останется в рабочем состоянии.

Визуализация предлагаемой видеоплаты зоны Ист-Энд на стадионе Отзен (Университет Орегона)

Хотя точные размеры экрана не указаны, размеры всей конструкции видеоплаты 186 ‘x 66’ составляют 12 276 квадратных футов, что превышает площадь 10 830 квадратных метров.